Top » Catalog » SNPs » YP515

$18.00

YP515
[YP515]

YP515
hg38 Position: ChrY:21163005..21163005
Ancestral: C
Derived: A
Reference: YFull.com
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream from CTS11962
Forward Primer: YP515_F CTTAAAAATTTCTCTATGGGCTGG
Reverse Primer: YP515_R TCCTGCAGCTGAACAAAAAG
Reviews

Customers who bought this product also purchased
CTS11962
CTS11962
YP254
YP254
M458
M458
Z93
Z93
A11460
A11460
R1a Superclade Panel
R1a Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies