Top » Catalog » SNPs » MC21

$18.00

MC21
[MC21]

MC21
HG19 Position: ChrY:14731636..14731636
Ancestral: C
Derived: T
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Immediately under R-DF41
Forward Primer: MC21_F TCAGATTTGCCAGTTACTCCAG
Reverse Primer: MC21_R TCCACGTGGTTAATTTCATTTG
Reviews

Customers who bought this product also purchased
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
DF49
DF49
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies