Top » Catalog » SNPs » MC21

$17.50

MC21
[MC21]

MC21
HG19 Position: ChrY:14731636..14731636
Ancestral: C
Derived: T
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Immediately under R-DF41
Forward Primer: MC21_F TCAGATTTGCCAGTTACTCCAG
Reverse Primer: MC21_R TCCACGTGGTTAATTTCATTTG
Reviews

Customers who bought this product also purchased
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
FGC11134
FGC11134
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies