Top » Catalog » SNPs » MC21

$18.00

MC21
[MC21]

MC21
hg38 Position: ChrY:12619704..12619704
Ancestral: C
Derived: T
Reference: Christopher McCown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i3
Comments: Immediately under R-DF41
Forward Primer: MC21_F TCAGATTTGCCAGTTACTCCAG
Reverse Primer: MC21_R TCCACGTGGTTAATTTCATTTG
Reviews

Customers who bought this product also purchased
Z253
Z253
FGC5494
FGC5494
DF49
DF49
Z251
Z251
DF13
DF13
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies