Top » Catalog » SNPs » A559

$18.00

A559
[A559]

A559
hg38 Position: ChrY:7117028..7117028
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A559_F TGACTTCCCACAACATGTGTG
Reverse Primer: A559_R TCCATGAAAGTACTGGATGGC
Reviews

Customers who bought this product also purchased
A573
A573
A565
A565
A571
A571
A561
A561
A570
A570
A560
A560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies