Top » Catalog » SNPs » A30564

$18.00

A30564
[A30564]

A30564
hg38 Position: ChrY:19632258..19632258
Ancestral: G
Derived: A
Reference: YSEQ (2021)
ISOGG Haplogroup: J2
Comments: Below L25 > L588 > FGC5916
Forward Primer: A30564_F TGTGTCCTTGTTCTGTTGGTTG
Reverse Primer: A30564_R AATTCAGCTCTGCGCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies