Top » Catalog » SNPs » A30565

$18.00

A30565
[A30565]

A30565
hg38 Position: ChrY:26344876..26344876
Ancestral: C
Derived: T
Reference: YSEQ (2021)
ISOGG Haplogroup: J2
Comments: Below L25 > L588 > FGC5916
Forward Primer: A30565_F TCACAACCTACTCATCTGCCAG
Reverse Primer: A30565_R CGGCTAATTTTTTGTATTTTTAGTAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies