Top » Catalog » SNPs » Y246379

$18.00

Y246379
[Y246379]

Y246379
hg38 Position: ChrY:7737141..7737141
Ancestral: C
Derived: T
Reference: YFull (2021)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y246379_F TCAAACTAGTTGATTTATATTAGCTTCAGC
Reverse Primer: Y246379_R AATGCAGGCAAATGGAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies