Top » Catalog » SNPs » FGC90360

$18.00

FGC90360
[FGC90360]

FGC90360
hg38 Position: ChrY:12952841..12952841
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: J1
Comments: Below FGC1695 > ZS5340 > FT229949
Forward Primer: FGC90360_F CCAGATATCCAGAAGCTGCATC
Reverse Primer: FGC90360_R GGAAATAAGTAAATAAGTGGATAATAATATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies