Top » Catalog » SNPs » Y130074

$18.00

Y130074
[Y130074]

Y130074
hg38 Position: ChrY:20560121..20560121
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: J2b
Comments: Below M12 > M205 > Y170456
Forward Primer: Y130074_F TCCCACTATGAGGCCAGTTC
Reverse Primer: Y130074_R GGCCCATTTGGATAAGAACTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies