Top » Catalog » SNPs » FT37295

$18.00

FT37295
[FT37295]

FT37295
hg38 Position: ChrY:15618046..15618046
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: Below P109 > FT36856
Forward Primer: FT37295_F GCATCAAATATCAGAGGTGGC
Reverse Primer: FT37295_R CCAGCTTGGGAAATCTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies