Top » Catalog » SNPs » Y243108

$18.00

Y243108
[Y243108]

Y243108
hg38 Position: ChrY:8598055..8598055
Ancestral: G
Derived: T
Reference: YFull (2021)
ISOGG Haplogroup: I1
Comments: Below P109 > FT36856
Forward Primer: Y243108_F AGTATTGCAAGTGTTAGATTTATGCG
Reverse Primer: Y243108_R CCATCTGACTTTATTGCTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies