Top » Catalog » SNPs » ZS2003

$18.00

ZS2003
[ZS2003]

ZS2003
hg38 Position: ChrY:7309197..7309197
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 238741; downstream BY8
Forward Primer: ZS2003_F GCTCTGAAATCTGCAGCTCTTG
Reverse Primer: ZS2003_R CAAGTAGCTGAGACTATAGGCACCC
Reviews

Customers who bought this product also purchased
FGC32305
FGC32305
Z18231
Z18231
FGC19909
FGC19909
BY14469
BY14469
BY186722
BY186722
J1-BY8 Panel
J1-BY8 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies