Top » Catalog » SNPs » FGC29864

$19.00

FGC29864
[FGC29864]

FGC29864
hg38 Position: ChrY:16766016..16766016
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC1695 > BY8 > BY9
Forward Primer: FGC29864_F CCTTCTGAAACTATTCCAATCGTC
Reverse Primer: FGC29864_R AGCTCACTCATGAGTTGGCTG
Reviews

Customers who bought this product also purchased
A26337
A26337
FGC19909
FGC19909
J1-BY8 Panel
J1-BY8 Panel
BY9
BY9
Y134508
Y134508
BY4
BY4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies