Top » Catalog » SNPs » A561

$18.00

A561
[A561]

A561
hg38 Position: ChrY:8686270..8686270
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A561_F ATCTGAGACCCAAGAGGTGG
Reverse Primer: A561_R TGTGGGTCGTTGTCTCCTC
Reviews (1)

Customers who bought this product also purchased
M253
M253
FGC22179
FGC22179
FGC22189
FGC22189
FGC22185
FGC22185
FGC22184
FGC22184
FGC22183
FGC22183
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies