Top » Catalog » SNPs » FT415169

$18.00

FT415169
[FT415169]

FT415169
hg38 Position: ChrY:19915941..19915941
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below A151 > FT74196 > BY21620
Forward Primer: FT415169_F GAGCTGATTCCTTTTTCAAATAGC
Reverse Primer: FT415169_R CTTTTATCAGCCAATCAGCAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies