Top » Catalog » SNPs » Y188867

$18.00

Y188867
[Y188867]

Y188867
hg38 Position: ChrY:15910595..15910595
Ancestral: C
Derived: T
Reference: YFull (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y188867_F CTTCTTATGCCACTAATAAAGACATACAC
Reverse Primer: Y188867_R GCACTAGGGTCAGGTTTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies