Top » Catalog » SNPs » FGC19820

$18.00

FGC19820
[FGC19820]

FGC19820
hg38 Position: ChrY:12395873..12395873
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4415 > ZS1943 > ZS1939
Forward Primer: FGC19820_F GGAGGAAAGGAAGATCCACC
Reverse Primer: FGC19820_R GCTCTTCCGTAGAGCAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies