Top » Catalog » SNPs » Y296568

$18.00

Y296568
[Y296568]

Y296568
hg38 Position: ChrY:18870272..18870272
Ancestral: T
Derived: A
Reference: YFull (2021)
ISOGG Haplogroup: R1b-P312
Comments: .
Forward Primer: Y296568_F CTCTATGCTTCTGTAAGTTTGACTGC
Reverse Primer: Y296568_R CTGGTGGCATAGAATGACTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies