Top » Catalog » Y SNPs » A30032

$18.00

A30032
[A30032]

A30032
hg38 Position: ChrY:16299864..16299864
Ancestral: C
Derived: G
Reference: YSEQ (2021)
ISOGG Haplogroup: E1b
Comments: Below L19 > Y10550 > Y141637
Forward Primer: A30032_F CAAAACCTAGGGATACAATTTACAACAG
Reverse Primer: A30032_R TGACGCCATTTATTAAATAGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies