Top » Catalog » Y SNPs » BY4590

$18.00

BY4590
[BY4590]

BY4590
hg38 Position: ChrY:14946375..14946375
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5017 > BY4222
Forward Primer: BY4590_F TCAGCCTCCGGAGTAGTTAGC
Reverse Primer: BY4590_R ATACATATGTAACTAACCGGCGG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies