Top » Catalog » SNPs » A30855

$18.00

A30855
[A30855]

A30855
hg38 Position: CP086569.1:49273971..49273971
Ancestral: T
Derived: A
Reference: Khaled Madi (2022)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A30855_F GGTCCAAGCGATTGTCCTC
Reverse Primer: A30855_R GACCACTGTCTGTGCTGTGTC
Reviews

Customers who bought this product also purchased
ZS5005
ZS5005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies