Top » Catalog » SNPs » A565

$18.00

A565
[A565]

A565
hg38 Position: ChrY:15396972..15396972
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A565_F CTGAAGCTTTTACATCTTTGTTATATGTG
Reverse Primer: A565_R AGGCATGTGCATGGAAGC
Reviews (1)

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC22242
FGC22242
A567
A567
A566
A566
A573
A573
A561
A561
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies