Top » Catalog » SNPs » A565

$18.00

A565
[A565]

A565
hg38 Position: ChrY:15396972..15396972
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A565_F CTGAAGCTTTTACATCTTTGTTATATGTG
Reverse Primer: A565_R AGGCATGTGCATGGAAGC
Reviews (1)

Customers who bought this product also purchased
FGC22242
FGC22242
DNA Sample Kit
DNA Sample Kit
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A567
A567
A566
A566
A573
A573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies