Top » Catalog » SNPs » A31668

$18.00

A31668
[A31668]

A31668
hg38 Position: ChrY:17042810..17042810
Ancestral: A
Derived: G
Reference:
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A31668_F TGTCCTGCAAAGAGGAGGAAC
Reverse Primer: A31668_R GGCACCCACCTGCCAC
Reviews

Customers who bought this product also purchased
A31669
A31669
YSEQ-XTD
YSEQ-XTD
DYS481
DYS481
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
A31667
A31667
Y246062
Y246062
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies