Top » Catalog » SNPs » A31669

$18.00

A31669
[A31669]

A31669
hg38 Position: ChrY:19595167..19595167
Ancestral: T
Derived: A
Reference: YFull (2022)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A31669_F GAATGTATTTATTAAAGAAATTTTTTAGGCC
Reverse Primer: A31669_R TGGTCTGGAGCAAATCCTAGC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
A31667
A31667
Y246062
Y246062
A31668
A31668
YSEQ-XTD
YSEQ-XTD
DYS481
DYS481
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies