Top » Catalog » SNPs » A569

$18.00

A569
[A569]

A569
hg38 Position: ChrY:19211746..19211746
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A569_F TATGTTACAAAAACTTCCACTTACACC
Reverse Primer: A569_R CTGATGTGTCATTGATGTGCC
Reviews

Customers who bought this product also purchased
A560
A560
A570
A570
A559
A559
A567
A567
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies