Top » Catalog » SNPs » A569

$18.00

A569
[A569]

A569
hg38 Position: ChrY:19211746..19211746
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A569_F TATGTTACAAAAACTTCCACTTACACC
Reverse Primer: A569_R CTGATGTGTCATTGATGTGCC
Reviews

Customers who bought this product also purchased
A565
A565
A573
A573
A561
A561
A571
A571
A560
A560
A570
A570
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies