Top » Catalog » SNPs » FT330073

$18.00

FT330073
[FT330073]

FT330073
hg38 Position: ChrY:14575641..14575641
Ancestral: T
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT330073_F ATAATATCCTGCAGAGTGTTTTCCC
Reverse Primer: FT330073_R AAATTCCAACAGGCCTGCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies