Top » Catalog » SNPs » A570

$18.00

A570
[A570]

A570
hg38 Position: ChrY:19356711..19356711
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A570_F AAGTAGCCTGAATAGCCAAAGTAGTC
Reverse Primer: A570_R TTTTACCTGTGGTTTTGAGGTG
Reviews

Customers who bought this product also purchased
FGC22242
FGC22242
A567
A567
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
A565
A565
A573
A573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies