Top » Catalog » SNPs » Y98192

$18.00

Y98192
[Y98192]

Y98192
hg38 Position: ChrY:14992040..14992040
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y98192_F CACTTATACCAACCTCTAGAGTTGCA
Reverse Primer: Y98192_R CAAAATGTGAGCAGTAGCAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies