Top » Catalog » SNPs » FTB84227

$18.00

FTB84227
[FTB84227]

FTB84227
hg38 Position: ChrY:21193508..21193508
Ancestral: C
Derived: T
Reference: FTDNA (2022)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FTB84227_F TCTTTCCCCTGCTATTCTTGTAAC
Reverse Primer: FTB84227_R TCTTAAGTCCAACATTTCACAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies