Top » Catalog » SNPs » Y131389

$18.00

Y131389
[Y131389]

Y131389
hg38 Position: ChrY:13948773..13948773
Ancestral: A
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: I1
Comments: Below Z140 > L338 > S12289
Forward Primer: Y131389_F CCCTTGTAATATCCAGGAATTCATAGT
Reverse Primer: Y131389_R TGTTCATGAAGCTGATATATCTGGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies