Top » Catalog » SNPs » BY115658

$18.00

BY115658
[BY115658]

BY115658
hg38 Position: ChrY:15441215..15441215
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY115658_F ACTGATCTCCCTTCAGTTAAGCAG
Reverse Primer: BY115658_R CTTCATTCTCATCCAGGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies