Top » Catalog » SNPs » FGC68630

$18.00

FGC68630
[FGC68630]

FGC68630
hg38 Position: ChrY:17363094..17363094
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC7 > ZS4646 > FT78847
Forward Primer: FGC68630_F AAGTAGTTGAGGATGCCTTCAGA
Reverse Primer: FGC68630_R CAGCCTATAAAGTCCTATATTCAAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies