Top » Catalog » SNPs » FT78847

$18.00

FT78847
[FT78847]

FT78847
hg38 Position: ChrY:7910749..7910749
Ancestral: T
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below ZS4646 > Y13316
Forward Primer: FT78847_F AGAAAGTAGTCAGACTGTTACATAAGCAG
Reverse Primer: FT78847_R CATTTGTAAAAACATCCTGCAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x B405
$18.00
Haplogroup Info
Other products
Currencies