Top » Catalog » SNPs » FTA53522

$18.00

FTA53522
[FTA53522]

FTA53522
hg38 Position: ChrY:14829536..14829536
Ancestral: A
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: J1
Comments: Below FGC7
Forward Primer: FTA53522_F GTTGAGGATTAGGCATAGCTAAGC
Reverse Primer: FTA53522_R GGACATGCAAATGAAAACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies