Top » Catalog » SNPs » BY154444

$18.00

BY154444
[BY154444]

BY154444
hg38 Position: ChrY:15560864..15560864
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below Z93 > Z2122 > Y2619 > YP1074
Forward Primer: BY154444_F TGTTTATGGAAAACATTCACAAATG
Reverse Primer: BY154444_R TGCAGTGGACATAGGGAATAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies