Top » Catalog » SNPs » FT282457

$18.00

FT282457
[FT282457]

FT282457
hg38 Position: ChrY:14589856..14589856
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1a
Comments: Below Z93 > Z2122 > Y2619 > YP1366
Forward Primer: FT282457_F GCTGATTGGTGTATTTACAATCCTC
Reverse Primer: FT282457_R TCAGCTGCCTTCCCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies