Top » Catalog » SNPs » BY169301

$18.00

BY169301
[BY169301]

BY169301
hg38 Position: ChrY:7749941..7749941
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: BY169301_F AAGAATCACTGGGTCTTTAATGAAGA
Reverse Primer: BY169301_R CCCAGAATTTCTTTTAGTTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies