Top » Catalog » SNPs » FT6143

$18.00

FT6143
[FT6143]

FT6143
hg38 Position: ChrY:19434453..19434453
Ancestral: C
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT6143_F GGAATCACCATATTGAATGTACCTG
Reverse Primer: FT6143_R GGTCTGGTGGTAACAATTTCTGC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies