Top » Catalog » SNPs » FT49595

$18.00

FT49595
[FT49595]

FT49595
hg38 Position: ChrY:7147265..7147265
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4415
Forward Primer: FT49595_F CTGAGTCGTTGAAACTACAAGTGG
Reverse Primer: FT49595_R ATCCCATCTCTACTAAAAACATGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies