Top » Catalog » SNPs » A24928

$18.00

A24928
[A24928]

A24928
hg38 Position: ChrY:19529582..19529582
Ancestral: G
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: J1
Comments: Below S21237 > Y30093 > ZS7528
Forward Primer: A24928_F CCTATTCCTAATAACCTTGAATGTAACTG
Reverse Primer: A24928_R TTTTAGGTCGAATTGCACTCTG
Reviews

Customers who bought this product also purchased
J1-FGC5 Panel
J1-FGC5 Panel
ALK192
ALK192
A24925
A24925
A24911
A24911
BY175370
BY175370
ZS7539
ZS7539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies