Top » Catalog » SNPs » Y337955

$18.00

Y337955
[Y337955]

Y337955
hg38 Position: ChrY:8662713..8662713
Ancestral: C
Derived: A
Reference: YFull (2022)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y337955_F AGGCCTGATTGTGAGCTCTG
Reverse Primer: Y337955_R AGAGGGAAATGATTTTGACACTGAC
Reviews

Customers who bought this product also purchased
Y337745
Y337745
Y337924
Y337924
Y337798
Y337798
Y337909
Y337909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies