Top » Catalog » SNPs » A33602

$18.00

A33602
[A33602]

A33602
hg38 Position: ChrY:14516707..14516707
Ancestral: C
Derived: T
Reference: YFull (2022)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A33602_F TGACTGAAATTAATTTTAAATTTATGATAACC
Reverse Primer: A33602_R ATAAATAAGACATAGTTTTTGCTCTCACATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies