Top » Catalog » SNPs » Y245109

$18.00

Y245109
[Y245109]

Y245109
hg38 Position: ChrY:2960893..2960893
Ancestral: T
Derived: A
Reference: YFull (2021)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y245109_F TTATCTTGATGTTTTAAAAGTATTTCACAAATAG
Reverse Primer: Y245109_R CCTCCTCTATGACAACATCTTCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies