Top » Catalog » SNPs » Y86124

$18.00

Y86124
[Y86124]

Y86124
hg38 Position: ChrY:8341906..8341906
Ancestral: A
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1707 > ZS8508 > Y85182
Forward Primer: Y86124_F GGTACTAAATCTCACACATAAAAAGTGTTG
Reverse Primer: Y86124_R CATTACTTATGTGATGGGCCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies