Top » Catalog » SNPs » S1605

$18.00

S1605
[S1605]

S1605
hg38 Position: ChrY:12906394..12906394
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Below L 2 > Z291
Forward Primer: S1605_F AGCGGGACAGGTTATTTGTG
Reverse Primer: S1605_R AATTCGGAGGTCTTTGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies