Top » Catalog » SNPs » A573

$18.00

A573
[A573]

A573
hg38 Position: ChrY:21000599..21000599
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A573_F ATTTTCTGGGCAGGGCTAAG
Reverse Primer: A573_R CCTGGTCCCTTCTTACATGG
Reviews

Customers who bought this product also purchased
A559
A559
A567
A567
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
A565
A565
A571
A571
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23982
1 x A13138
1 x B444
1 x A24532
1 x BY29105
1 x B144
$108.00
Haplogroup Info
Other products
Currencies