Top » Catalog » SNPs » A573

$15.00

A573
[A573]

A573
hg38 Position: ChrY:21000599..21000599
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A573_F ATTTTCTGGGCAGGGCTAAG
Reverse Primer: A573_R CCTGGTCCCTTCTTACATGG
Reviews

Customers who bought this product also purchased
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
A565
A565
A571
A571
A561
A561
A570
A570
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies