Top » Catalog » SNPs » A573

$18.00

A573
[A573]

A573
hg38 Position: ChrY:21000599..21000599
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A573_F ATTTTCTGGGCAGGGCTAAG
Reverse Primer: A573_R CCTGGTCCCTTCTTACATGG
Reviews

Customers who bought this product also purchased
A571
A571
A561
A561
A570
A570
A560
A560
A569
A569
A559
A559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies