Top » Catalog » SNPs » BY50475

$18.00

BY50475
[BY50475]

BY50475
hg38 Position: ChrY:12763995..12763995
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY50475_F CTCAGCAACAATGTCAGTGC
Reverse Primer: BY50475_R CTCCATTTATTTTAATCAACATAAAGGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies